Regresar

First report of Alfalfa mosaic virus in red pepper plants in Ecuador

Abstract:

In a survey of viral diseases conducted in November 2014 in Imbabura Province, Ecuador, we observed severe yellow mosaic, chlorosis, and leaf deformation symptoms in approximately 70% of the red pepper (Capsicum annuum) plants. In Ecuador, pepper production in 2012 was estimated at 5,500 tons cultivated on 1,700 ha (FAOSTAT). Although nearly 90% of the total pepper production is destined for domestic consumption, the possibility of the exportation of fresh peppers from Ecuador to the United States is under consideration (https://www.federalregister.gov). Leaves were collected from six symptomatic plants of a commercial field located in the Antonio Ante Canton. Samples were analyzed to determine the presence of Alfalfa mosaic virus (AMV), which is known to infect pepper plants inducing similar symptoms (Abdalla and Ali 2012) and has also been shown to infect tamarillo (Solanum betaceum) cultivars in Ecuador (Ochoa et al. 2004). Total RNAs were extracted using TRI reagent (SIGMA, St. Louis, MO, USA) according to the manufacturer instructions and resuspended in 50 μl of sterile water. Extracted total RNAs (3 μl) were spotted on a nylon membrane and hybridized overnight at 68°C with an AMV-specific digoxigenin-labeled riboprobe complementary to part of the coat protein (CP) coding gene, as described previously (Mandic et al. 2008). Total RNAs extracted from 3 virus-free plants maintained under controlled conditions were used as hybridization controls. Two out of the six analyzed samples, exhibiting severe yellow mosaic and chlorosis, were determined to be AMV-infected by hybridization assays. To further confirm the AMV identity, total RNAs obtained from positive samples were subjected to RT-PCR assays using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen Corporation, Carlsbad, CA, USA) and the primers VP1214-S CGCTCTCGAGAAGTTCGGGTTTGAG and VP1215-R TCTCGTCGACGATCAAGATCGTCAGC, specific for a region of AMV CP (position 537-780 in GenBank Accession No. J02006). RNAs extracted from AMV-negative samples in hybridization assays were used as RT-PCR control. Amplified fragments of the expected 240-bp size were obtained only from the two samples that were positive in the hybridization assays, providing additional evidence for the presence of AMV in S2 and S3 samples. Nevertheless, these results cannot exclude the possibility for infections of AMV-negative samples that exhibited leaf deformation and chlorosis with other viruses. The specific amplicons from both positive samples were purified from the agarose gel (Wizar PCR, Promega) and cloned in the vector pTZ57R (InsT/Aclone PCR, Fermentas). Two clones from each AMV-positive sample were sequenced and subjected to downstream computational analysis. BLASTn analysis revealed that the consensus sequence determined for this AMV isolate (GenBank Accession No. KT336366.1) was 100% identical to the strain WC3 of the AMV (GenBank Accession No. JN209847). To our knowledge, this is the first report of AMV in red pepper in Ecuador. Further studies will make it possible to determine the geographic distribution and incidence of AMV in pepper fields and the routes through which this virus may have been introduced to Ecuador.